View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14608_high_5 (Length: 400)
Name: NF14608_high_5
Description: NF14608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14608_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 11 - 369
Target Start/End: Complemental strand, 40092146 - 40091788
Alignment:
| Q |
11 |
caaaggaaaggtgtgaagacttttcttccccttaacttttgttgtctttcttttcgcggggtccagattgcttgcaatcacaaaatgttgtagtcgctgc |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
40092146 |
caaaggaaaggtgtgaagactttttttccccttaacttttcttgtctttcttttcgcggggtccagattgctttcaatcaaaaaatgttgtagtcgctgc |
40092047 |
T |
 |
| Q |
111 |
agttcgtaaacgtcgatcattagatggagatcagtcagttaatatgatttacaatgttgtaatggttgtttcaggctgcggttgctcaagctgtcttggc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40092046 |
agttcgtaaacgtcgatcattagatggagatcagtcagttaatatgatttacaatgttgtaatggttgtttcaggctgcggttgctcaagctgtcttggc |
40091947 |
T |
 |
| Q |
211 |
ttaccagctttaccagaaaatgttttctggtccaagatgggagcgcctggagaagagaggtgccaagaagcaaagattgatgtgggcatcgacaaatgtg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40091946 |
ttaccagctttaccagaaaatgttttctggtccaagatgggagcgcctggagaagagaggtgccaagaagcaaagattgatgtgggcatcgacaaatgtg |
40091847 |
T |
 |
| Q |
311 |
aaaaattcagcttactctgatactttttatgttaattctcttattggaccagatacggt |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40091846 |
aaaaattcagcttactctgatactttttatgttaattctcttattggaccagatacggt |
40091788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University