View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14609_high_4 (Length: 350)
Name: NF14609_high_4
Description: NF14609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14609_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 2 - 342
Target Start/End: Original strand, 32259001 - 32259340
Alignment:
| Q |
2 |
atcctaacttcagtgaaggtgacttggtatgggggataactagttgggaagaatatagtctaattcaaaatccagacaaactctacaaaatccatcacac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259001 |
atcctaacttcagtgaaggtgacttggtatgggggataactagttgggaagaatatagtctaattcaaaatccagacaaactctacaaaatccatcacac |
32259100 |
T |
|
| Q |
102 |
tgatgtgcctctttcctattacactggaattcttggtaattgagttcttctcaaannnnnnnattatgctttttctgaatgtaatgctgaaaagaaatga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259101 |
tgatgtgcctctttcctattacactggaattcttagtaattgagttcttctcaa-gttttttattatgctttttctgaatgtaatgctgaaaagaaatga |
32259199 |
T |
|
| Q |
202 |
taaatctattatgagagtcagtttttggtagcttctgatgtattttattctttctaatccaataggcatgcctggtattactgcatatgccggaatcttt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259200 |
taaatctattatgagagtcagtttttggtagtttctgatgtattttattctttctaatccaataggcatgcctggtattactgcatatgccggaatcttt |
32259299 |
T |
|
| Q |
302 |
gaagttggttctctaaagaaaggagaaagcgtcttcatctc |
342 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32259300 |
gaagttggttctctaaagaaaggagaaagtgtcttcatctc |
32259340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University