View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_high_11 (Length: 429)
Name: NF1460_high_11
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 11 - 413
Target Start/End: Original strand, 50466204 - 50466606
Alignment:
| Q |
11 |
atgaacgtggacctggctcaagcttttaagagtctagaccgggacgaatcggttcgggtgattatattaaccggaactggtagatcgttctgttccggcg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50466204 |
atgaacgtggacctggctcaagcttttaagagtctagaccgggacgaatcggttcgggtgattatattaaccggaactggtagatcgttctgttctggcg |
50466303 |
T |
 |
| Q |
111 |
ttgacctcacggcagcggaggatgttttcaagggtgatgtgaaggatccggaaagtgacccggttgtgcaaatggagcggtgtcgtaaaccgataattgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50466304 |
ttgacctcacggcagcggaggatgttttcaagggtgatgtgaaggatccggaaagtgacccggttgtgcaaatggagcggtgtcataaaccgataattgg |
50466403 |
T |
 |
| Q |
211 |
agcgattaaaggatttgctgttaccgctggatttgagattgcacttgcttgtgatattttggttgctgctaaaggcgccaaattcatggatactcacgct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50466404 |
agcgattaaaggatttgctgttaccgctggatttgagattgcacttgcttgtgatattttggttgctgctaaaggcgccaaattcatggatactcacgct |
50466503 |
T |
 |
| Q |
311 |
aggttccttaagttcctttcctttttattgcaaaattcaattttattaaggattgctatcattgtcaatgataattcaataatagcttatattatatgag |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50466504 |
aggttccttaagttcctttcctttttattgcaaaattcaattttattaaggattgctatcattgtcaatgataattcaataatagcttatattatatgag |
50466603 |
T |
 |
| Q |
411 |
aag |
413 |
Q |
| |
|
||| |
|
|
| T |
50466604 |
aag |
50466606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University