View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_high_32 (Length: 253)
Name: NF1460_high_32
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 5182230 - 5181996
Alignment:
| Q |
1 |
ttgaaaatttgagttggactaattcaactttacaaaatcaactgtggagagtgccctcacttatacaaacacatttttaggccatatttcatccattgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| | |||||||||||||||||||||||||| | |
|
|
| T |
5182230 |
ttgaaaatttgagttggactaattcaactttacaaaatcaactgtggagagtgtcctgacttatacaaagatatttttaggccatatttcatccattggc |
5182131 |
T |
 |
| Q |
101 |
ttttgaaatatcatttgttgctggaaaacttggccacttattagtctgtcccattgatgcataccttaaagccgtaatgcataatcttatattcatcaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5182130 |
ttttgaaatatcatttgttgctggaaaacttggccacttattagtctatcccattgatgcataccttaaagccgtaatgcataatcttatgttcatcaaa |
5182031 |
T |
 |
| Q |
201 |
actgagtccatgtcaaggattgttcttcggtgcttc |
236 |
Q |
| |
|
|| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
5182030 |
ac-gagtccatgtcaaggattattctttggtgcttc |
5181996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University