View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_high_33 (Length: 250)
Name: NF1460_high_33
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_high_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 2 - 244
Target Start/End: Original strand, 8052904 - 8053137
Alignment:
| Q |
2 |
aaacttttagataaagacattctgagaaggaaaaattgaaaacacttaatataaatatatcaattggataagatagtaaactaaataatctcttccggct |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8052904 |
aaacttttagataaagacattctgagaaggaaaaattgaaaacac---------atatatcaattggataagatagtaaactaaataatctcttccggct |
8052994 |
T |
|
| Q |
102 |
taactagatatcatgaatttgaatccaattttaagaatgcagtgcagttaaatttcttgatggagagatttttcatctattgcaatcatatccaaggtta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8052995 |
taactagatatcatgaatttgaatccaattttaagaatgcagcgcagttaaatttcttgatggagagatttttcatctattgcaatcatatccaagatta |
8053094 |
T |
|
| Q |
202 |
taaattaatctctacaattatgcgtagaagatattcatctcac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8053095 |
taaattaatctctacaattatgcgtagaagatattcatgtcac |
8053137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University