View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_29 (Length: 381)
Name: NF1460_low_29
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 121755 - 122041
Alignment:
| Q |
19 |
gtaaagtattggagctacggaggcagaaggaaatgttgcgggcacaccaacaccaacaaagccagattttacaacatcagagtatgatgtttgatatgtc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121755 |
gtaaagtattggagctacggaggcagaaggaaatgttgcgggcacaccaacaccaacaaaaccagattttacaacatcagagtatgatgtttgatatgtc |
121854 |
T |
|
| Q |
119 |
caataatgatgattacttgattcaccaacatatgggacctgattttaggcagatgatgtagtaggtgctagattatacaacatattagaacatctactgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121855 |
caataatgatgattacttgattcaccaacatatgggacctgattttaggcagatgatgtagtaggtgctagattatacaacatattagaacatctactgt |
121954 |
T |
|
| Q |
219 |
ggagcctcacagttaattgattttgtagtagagttatacaactttttatatttgttttccattataaaattttgttagcgattatac |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121955 |
ggagcctcacagttaattgattttgtagtagagttatacaactttttatatttgttttccattataaaattttgttagcgattatac |
122041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University