View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_30 (Length: 380)
Name: NF1460_low_30
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 42452609 - 42452424
Alignment:
| Q |
1 |
tttcacgacattcaagtcacctacaccactgaatatcatatcaatataagtctttgttgagatcgatgtcaataacaaagaacgnnnnnnn-ttgaaaat |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42452609 |
tttcacaacattcaagtcacctacaccactgaatatcagatcaatataagtctttgttgagatcgatgtcaataacaaagaacgaaaaaaaattgaaaat |
42452510 |
T |
|
| Q |
100 |
agagtgatagtttaaccaactctcgcctaaatcatctcgatatatcataccaaactcggagagtggtctcacacactacaagtaga |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42452509 |
agagtgatagtttaaccaactctcgcctaaatcatctcgatatattataccaaactcggagagtggtctcacacactacaagtaga |
42452424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 299 - 361
Target Start/End: Complemental strand, 42452326 - 42452264
Alignment:
| Q |
299 |
ttggatatgcatgtatttgtcagttttcacggggccaacaacattctcattccccttatggca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42452326 |
ttggatatgcatgtatttgtcagttttcacggggccaacaacattctcattccccttatggca |
42452264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 202 - 235
Target Start/End: Complemental strand, 42452412 - 42452379
Alignment:
| Q |
202 |
ataagggacaaatagatgttttatgtatgcggcc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42452412 |
ataagggacaaatagatgttttatgtatgcggcc |
42452379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University