View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_42 (Length: 316)
Name: NF1460_low_42
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 10 - 300
Target Start/End: Complemental strand, 50393906 - 50393616
Alignment:
| Q |
10 |
aagaaaatcattttcgttaaaagtgataaatatttgctgtacttgccattgattttggtcttgtctatgtgccatttgtattataattatctccggtgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50393906 |
aagaaaatcattttcgttaaaagtgataaatatttgctgtacttgccattgattttggtcttgtctatgtgccatttgtattataattatctccggtgaa |
50393807 |
T |
 |
| Q |
110 |
tgattccatgcatgataactgtacggcttgatacagggtgtagaaggccactagcagcagcaaacatcatcccataacatatttaaactaaatatagaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50393806 |
tgattccatgcatgataactgtacggcttgatacggggtgtagcaggccactagcagcagcaaacatcatcccataacatatttaaactaaatatagaaa |
50393707 |
T |
 |
| Q |
210 |
tgatatcagttaactagctagtaaagagaaatcaaaatacgatgagttgaaactgatacttatatgttctaaacaaactaaccgaaccaac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50393706 |
tgatatcagttaactagctagtaaagagaaatcaaaatacgatgagttgaaactgatacttatatgttctaaacaaactaaccgaaccaac |
50393616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University