View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_48 (Length: 278)
Name: NF1460_low_48
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 13 - 136
Target Start/End: Original strand, 42452596 - 42452719
Alignment:
| Q |
13 |
tgaatgtcgtgaaatgatcgacgttatctttaattagtggatgaaataaaattattttcatggaaatggttaccttcttacatacttacttaattagaca |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42452596 |
tgaatgttgtgaaatgatcgacgttatctttaattagtggatgaaataaaattattttcatggaaatggttaccttcttacatacttacttaattagaca |
42452695 |
T |
|
| Q |
113 |
atcgtctattgttttcaccgaatc |
136 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
42452696 |
atcctctattgttttcaccgaatc |
42452719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 212 - 263
Target Start/End: Original strand, 42452795 - 42452846
Alignment:
| Q |
212 |
actcccaccatctctagactttcttcttggcttgagttgagaccattagctg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42452795 |
actcccaccatctctagactttcttcttggcttgagttgagaccattagctg |
42452846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University