View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_53 (Length: 263)
Name: NF1460_low_53
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_53 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 263
Target Start/End: Original strand, 6816822 - 6817066
Alignment:
| Q |
19 |
tgaatattatactccatgttattttgtggttgagcaacaatacaaataatacctcaaactaagaccagttcggtaatcgagtttaggaaggaaaccgaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6816822 |
tgaatattatactccatgttattttgtggttgagcaacaatacaaataatacctcaaactaagaccagttcggtaatcgagtttaggaaggaaaccgaac |
6816921 |
T |
|
| Q |
119 |
caatttcaactgttataacagttcggtaaaattaaaccgaattgtaaatggttcgcccaaaatcgaacagaggctaactggtctggcataaaggtttggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6816922 |
caatttcaactgttataacagttcggtaaaattaaaccgaattgtaaatggttcgcccgaaatcgaacagaggctaactggtctggcataaaggtttggt |
6817021 |
T |
|
| Q |
219 |
tcaacggtactgtggtttcaaaccaaacttgattctttgtgaatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6817022 |
tcaacggtactgtggtttcaaaccaaacttgattctttgtgaatt |
6817066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University