View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_55 (Length: 258)
Name: NF1460_low_55
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 4442835 - 4442711
Alignment:
| Q |
17 |
aaaataagcaggactaagttttatattttatcgaataatattttaaattttctatgttcctatctaggggtgtcaaatgggctggtcttgtcggccctgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4442835 |
aaaataagcaggactaagttttatattttatcgaataatattttaaattttctattttcctatctaggggtgtcaaatgggctggtcttgccggccctgg |
4442736 |
T |
|
| Q |
117 |
gtgggccaactgcataaatggatca |
141 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4442735 |
gtgggccaactgcataaatggatca |
4442711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 218 - 248
Target Start/End: Complemental strand, 4442577 - 4442547
Alignment:
| Q |
218 |
gttactcacaactatctttttgctaagatat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4442577 |
gttactcacaactatctttttgctaagatat |
4442547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University