View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_56 (Length: 255)
Name: NF1460_low_56
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 107 - 248
Target Start/End: Complemental strand, 43937254 - 43937114
Alignment:
| Q |
107 |
gtgattcataccgccaggaattagaagctgagaatgcaaatcttttatctcgacttgctcattgccagtgctccgaggttagctactcgattgtttcata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43937254 |
gtgattcataccgccaggaattagaagctgagaatgcaaatcttttatctcgacttgctcattgccagtgctccgaggttagctactcgattgtttcata |
43937155 |
T |
|
| Q |
207 |
tttcttttgnnnnnnnncgtgctatgtttgttttattttctt |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43937154 |
tttcttttg-tttttttcgtgctatgtttgttttattttctt |
43937114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 43937375 - 43937301
Alignment:
| Q |
1 |
ttgcactcattttatactatatgataaattgatagcatagcaatgtaggcatcaaggattatgcattattcttag |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43937375 |
ttgcactcattttatactatatgataaattgatagcatagcaatgtaggcatcaaggattatgcattattcttag |
43937301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University