View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_61 (Length: 250)
Name: NF1460_low_61
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_61 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 39620407 - 39620173
Alignment:
| Q |
16 |
ttctggtacatattttttgttttcttcacctccctatactgtacctactacggcatgatgacaatggctataaccccaaaccaaaccattgtctctttcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39620407 |
ttctggtacatattttttgttttcttcacctccctatactgtacctactacggcatgatgacaatagctataaccccaaaccaaaccattgtctctttcc |
39620308 |
T |
|
| Q |
116 |
ttacccgtccgtcctatgtattatggaatcttttctcaggaactgttgtcccaccaccagtaagtttttacttcctttaatgataagtgataagttttac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39620307 |
ttacccgtccgtcctatgtattatggaatcttttctcaggaactgttgtcccaccaccagtaagtttttacttcctttaatgataagtgataagttttac |
39620208 |
T |
|
| Q |
216 |
ttttcaaagattttctgtatagaaataatttctta |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39620207 |
ttttcaaagattttctgtatagaaataatttctta |
39620173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University