View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_65 (Length: 248)
Name: NF1460_low_65
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 32143980 - 32143768
Alignment:
| Q |
16 |
acaaaagagtgggattatagttgttgagagaaacagacatatgaggatgagggggaaaacatgggttaagacacgtcaacaaggagcagctaaaaacgca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32143980 |
acaaaagagtgggattatagttgttgagagaaacagacatatgaggatgagggggaaaacatgggttaagacacgtcaacaaggagcagctaaaaacgca |
32143881 |
T |
 |
| Q |
116 |
gaaccataatttctctactctcccgacaacgacacacacactcacgagtgacgagtcactaccattccctccctccactcaccctccggcctccatttcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32143880 |
gaaccataatttctctactctcccgacaacgacacacacactcacgagtgacgagtcactaccattcc----ctccactcaccctccggcctccatttcc |
32143785 |
T |
 |
| Q |
216 |
ctccctttatctctctc |
232 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32143784 |
ctccctttatctctctc |
32143768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University