View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_69 (Length: 244)
Name: NF1460_low_69
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 115 - 208
Target Start/End: Complemental strand, 8052677 - 8052584
Alignment:
| Q |
115 |
tcttctttcaaccatattttatggctgagagtacattatgagtggaaaagtattaaacatcctacacaaatcagcgttctatgattaatcatac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8052677 |
tcttctttcaaccatattttatggctgagagtacattatgagtggaaaagtattaaacatcctacacaaatcagcgttctatgattaatcatac |
8052584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University