View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_73 (Length: 239)
Name: NF1460_low_73
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 10820867 - 10821082
Alignment:
| Q |
17 |
aatggttcattagtcattgaagctcaagtaaatattccactaagcaatttagatttttataatctcaatgaaactcttgaagaaaagatagtctcagttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10820867 |
aatggttcattagtcattgaagctcaagtaaatgttccactaagaaatttagatttttataatctcaatgaaactcttgaagaaaagatagtctcaattg |
10820966 |
T |
|
| Q |
117 |
aaccagatttccctttacaaattcaggtaacagaatttacttgtggtggaatttcaatagcatttacttttgatcatgcattaggtgatgcaacttcatt |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10820967 |
aactagatttccctttacaaattcaggtaacagaatttacttgtggtggaatttcaatagcatttacttttgatcatgcattaggtgatgcaacttcatt |
10821066 |
T |
|
| Q |
217 |
tggtaaattcatttca |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10821067 |
tggtaaattcatttca |
10821082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University