View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_76 (Length: 237)
Name: NF1460_low_76
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_76 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 28384812 - 28384592
Alignment:
| Q |
1 |
tctttgtgaaagaagatgtatattatattttattttattctgtaacattagtaaatatgttgaatcagtattatgcaaatgaatgtggtactactcttta |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28384812 |
tctttgtgaaagaagatgtattttatattttattttattctgtaacattagtaactatgttgaatcagtattatgcaaatcaatgtggtactactcttta |
28384713 |
T |
|
| Q |
101 |
tctggtgtcaaggttcttggttctgtttcaggtttaactccaattttaagtatcacaagtccttctatacggtctcaaacaatcccatatgcaataatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28384712 |
tctggtgtcaaggttcttggttctgtttcaggtttaactccaattttaagtatcataagtccttctatatggtctcaaacaatcccatatgcaataatat |
28384613 |
T |
|
| Q |
201 |
tcaaagttggcatcaacctgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28384612 |
tcaaagttggcatcaacctgg |
28384592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 137
Target Start/End: Original strand, 42493446 - 42493497
Alignment:
| Q |
86 |
tggtactactctttatctggtgtcaaggttcttggttctgtttcaggtttaa |
137 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| || || |||||| |
|
|
| T |
42493446 |
tggtactgctctttatctggtgtcaacgttcttggttctattccatgtttaa |
42493497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University