View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_77 (Length: 236)
Name: NF1460_low_77
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_77 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 10547675 - 10547557
Alignment:
| Q |
102 |
tacgaaagctgcttaccaacagtcatccactggggaggaacaatggagcacttgcctctcctcctgagagcaattgccaaccaaagtggtacttgagtaa |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10547675 |
tacgaaagcttcttaccaacagtcatccactggggagggacaatggagcacttgcctctcctcctgagagcaattgccaaccaaagtggtacttgagtaa |
10547576 |
T |
|
| Q |
202 |
caatctgtggcgtaaatgg |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10547575 |
caatctgtggcgtaaatgg |
10547557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 15 - 84
Target Start/End: Complemental strand, 10547942 - 10547874
Alignment:
| Q |
15 |
cagagtaagaaattcaacaaaaaataacatcaaagttgttggaacaaaattgtaaatcataaacacattc |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10547942 |
cagagtaagaaattcaacaaaaaataacatcaaagttgttggaac-aaattgtaaatcataaacacattc |
10547874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University