View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_81 (Length: 232)
Name: NF1460_low_81
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_81 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 88 - 199
Target Start/End: Original strand, 43596683 - 43596799
Alignment:
| Q |
88 |
taatagattcttttggagaagatgtctcattgttagttcgttgatcgaatcagaaatggatgcgatgcggtggatt----actccatctgcgt-aaagtg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
43596683 |
taatagattcttttggagaagatgtctcattgttagttcgttgatcgaatcagaaatggatgcgatgcggtggattactcactccatctgcgtaaaagtg |
43596782 |
T |
|
| Q |
183 |
gaacagaaatgaaaatg |
199 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43596783 |
gaacagaaatgaaaatg |
43596799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University