View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_84 (Length: 225)
Name: NF1460_low_84
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_84 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 52359119 - 52358926
Alignment:
| Q |
14 |
cataggttcatcaaaatttactggtagatagactaagagtgcaaaatacattgcatagtatagttgtaaggattaatatgatataccaagaacctttttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52359119 |
cataggttcatcaaaatttactggtagatagactaag--tgcaaaatacattgcatagtatagttgtaaggattaatatgatataccaagaacctttttg |
52359022 |
T |
|
| Q |
114 |
ctacgtaatatgtctccgtaaatgtgatccccaacatacagaacctacacataaagcatccagatttttacaggaagcttcagtaataacaataat |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52359021 |
ctacgtaatatgtctccataaatgtgatccccaacatacagaacctacacataaagcatccagatttttacaggaagcttcagtaataacaataat |
52358926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 80 - 162
Target Start/End: Complemental strand, 6987462 - 6987380
Alignment:
| Q |
80 |
taaggattaatatgatataccaagaacctttttgctacgtaatatgtctccgtaaatgtgatccccaacatacagaacctaca |
162 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||| |||| ||| ||||| ||||| ||||| ||||||||||||||||||| |
|
|
| T |
6987462 |
taaggattcatataatataccaagaacctttttgctgcgtagtatatctccataaatatgatctccaacatacagaacctaca |
6987380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University