View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1460_low_92 (Length: 211)
Name: NF1460_low_92
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1460_low_92 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 44 - 211
Target Start/End: Original strand, 46935781 - 46935948
Alignment:
| Q |
44 |
cttttgaagtaatttgtaattcagaaacgcaacctggctttgccagtgaaaatccatctatcaataccgatttagatttcggccttcaaccggaattcat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46935781 |
cttttgaagtaatttgtaattcagaaacgcaacctggctttgccagtgaaaatccatctatcaataccgatgtagatttcggccttcaaccggaattcat |
46935880 |
T |
|
| Q |
144 |
ggttcaaaagtcaggctttcagcctcccgtctcaccgattcaaacagcacagaggataggtacctctc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46935881 |
ggttcaaaagtcaggctttcagcctcccgtctcaccgattcaaacagcacagaggataggtacctctc |
46935948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 211
Target Start/End: Complemental strand, 865263 - 865202
Alignment:
| Q |
150 |
aaagtcaggctttcagcctcccgtctcaccgattcaaacagcacagaggataggtacctctc |
211 |
Q |
| |
|
||||||| | ||||||| ||||||||||| || ||||| ||||||||||| ||||||||||| |
|
|
| T |
865263 |
aaagtcatggtttcagcttcccgtctcactgactcaaatagcacagaggacaggtacctctc |
865202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University