View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14612_high_3 (Length: 327)
Name: NF14612_high_3
Description: NF14612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14612_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 12696728 - 12696418
Alignment:
| Q |
1 |
tgcatatgcatcaaagatcaaattttgaatagtatattcattgacccttgtgtgcatatgcaacaaaggtaaaattttgaatagttttgcataatcaatt |
100 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12696728 |
tgcatatgtaacaaagatcaaattttgaatagtatattcattgacccttgtgtgcatatgcaacaaaggtaaaattttgaatagttttgcataatcaatt |
12696629 |
T |
|
| Q |
101 |
gtgtgaaagaatagctttgaattcattcaattttgagttttgattcatggacaatcatggttctgcacctccatatggatatccaaacccttatgcatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12696628 |
gtgtgaaagaatagctttgaattcattcaattttgagttttgattcatggacaatcatggttctgcacctccatatggatatccaaacccttatgcatat |
12696529 |
T |
|
| Q |
201 |
cctccatatccataccctcctccaaatccatctcatgatccatatgcacctacaccagtatcttctccttatccatatgaatcatatccaccaaattctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12696528 |
cctccatatccataccctcctccaaatccatctcatgatccatatgcaccttcaccagtatcttctccttatccatatgaatcatatccaccaaattctt |
12696429 |
T |
|
| Q |
301 |
cgcattccttc |
311 |
Q |
| |
|
| ||||||||| |
|
|
| T |
12696428 |
cacattccttc |
12696418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 12696780 - 12696696
Alignment:
| Q |
1 |
tgcatatgcatcaaagatcaaattttgaatagtatattcattgacccttgtgtgcatatgcaacaaaggtaaaattttgaatagt |
85 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||| |||||||| |||||||||| ||||||| | |||||||||||||| |
|
|
| T |
12696780 |
tgcatatgcatcaaagatcaaatttttaataccatattctgtgacccttttgtgcatatgtaacaaagatcaaattttgaatagt |
12696696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 12696832 - 12696750
Alignment:
| Q |
1 |
tgcatatgcatcaaagatcaaattttgaatagtatattcattgacccttgtgtgcatatgcaacaaaggtaaaattttgaata |
83 |
Q |
| |
|
||||||||||||||||||||||| || |||| || ||| ||||||||| |||||||||||| ||||| | ||||||| |||| |
|
|
| T |
12696832 |
tgcatatgcatcaaagatcaaatatttaatatcattttctttgacccttttgtgcatatgcatcaaagatcaaatttttaata |
12696750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University