View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14612_high_9 (Length: 236)
Name: NF14612_high_9
Description: NF14612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14612_high_9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 236
Target Start/End: Complemental strand, 39489509 - 39489288
Alignment:
| Q |
15 |
tcgatccttatatattattgtccatagggcaatggacaccacttcttatgagtaggttcattagaaataaccaacctattgctcaacaggccatttcctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39489509 |
tcgatccttatatattattgtccataaggcaatggacaccacttcttatgagtaggttcattagaaataaccaacctattgctcaacatgccatttcctc |
39489410 |
T |
|
| Q |
115 |
catttggttaggattcaaacctcacttcaatgaggtcattcataattccatttggattataggtaagggaactaacatcaatttttggaatgattattgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39489409 |
catttggttaggattcaaacctcacttcaatgaggtcattcataattccatttggattataggtaagggaactaacattaatttttggaatgattattgt |
39489310 |
T |
|
| Q |
215 |
attggctcccctatttctgata |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39489309 |
attggctcccctatttctgata |
39489288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University