View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14612_low_8 (Length: 255)
Name: NF14612_low_8
Description: NF14612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14612_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 44965573 - 44965801
Alignment:
| Q |
18 |
aaattctccggcgaggggatgacagtgacggcttcgccgtcgtcttcaccggcggttggctctttgaggaaagagaaacaggggagttttccggctggga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965573 |
aaattctccggcgaggggatgacagtgacagcttcaccgtcgtcttcaccggcggttggctctttgaggaaagagaaacaggggagttttccggctggga |
44965672 |
T |
|
| Q |
118 |
tgagagtggtaacgaagcatttgggtaagagtaggtcatcgggtacggtggccggagccagttctccggcgaacaggagtgatgatacgctgttgcagca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44965673 |
tgagagtggtaacgaagcatttgggtaagagtaggtcatcgggtacggtggccggagctagttctccggcgaacaggagtgatgatacgttgttgcagca |
44965772 |
T |
|
| Q |
218 |
gcatgatggaattcaaagtgctattcttc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44965773 |
gcatgatggaattcaaagtgctattcttc |
44965801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 137 - 236
Target Start/End: Original strand, 28697958 - 28698056
Alignment:
| Q |
137 |
tttgggtaagagtaggtcatcgggtacggtggccggagccagttctccggcgaacaggagtgatgatacgctgttgcagcagcatgatggaattcaaagt |
236 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||| || |||||||||| | ||||||||| | | |||||||||| |||||||||| |||||| |
|
|
| T |
28697958 |
tttgggtaagagtaggtcgccggataccgtggccggagttggtactccggcgaataagagtgatga-atgttgttgcagcaagatgatggaatccaaagt |
28698056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University