View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14613_high_13 (Length: 236)
Name: NF14613_high_13
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14613_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 5 - 152
Target Start/End: Original strand, 44428459 - 44428606
Alignment:
| Q |
5 |
gaagaaaagtgagttgaaaatttgcttagaatttactttttaacggctatgtggagtgaaagggatgagggtgtgtgtgtatttctttactacactcaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44428459 |
gaagaaaagtgagttgaaaatttgcttagaatttactttttaacggttatgtggagtgaaagggatgagggtgtgtgtgtatttctttactacactcaaa |
44428558 |
T |
 |
| Q |
105 |
attgcaagtctccccaatttcacgcctccaccctgaattggagagtaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44428559 |
attgcaagtctccccaatttcacgcctccaccctgaattggagagtaa |
44428606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 44428631 - 44428690
Alignment:
| Q |
152 |
aaaagacagggaaataattgaaggaatgtcagaaaaac-agaacatcataggaggcaggg |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
44428631 |
aaaaaacagggaaataattgaaggaatgtcagaaaaacaaaaacatcataggagggaggg |
44428690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University