View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14613_high_15 (Length: 230)
Name: NF14613_high_15
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14613_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 6412826 - 6412625
Alignment:
| Q |
16 |
catcaactatcatgttttcggacaagtgatcccttgctgtgggtagagttatcgctaggcgagtatcaacctcttcacataacttcttaatcctcctctt |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6412826 |
catctactatcatgttttcggacaagtgatcccttgctgtgggtagagttatcgccaggcgagtatcaacctcttcatataacttcttaatcctcctctt |
6412727 |
T |
 |
| Q |
116 |
ccaaatgcaccataatgctctaacaaatattttcgattgattagatgacaacaattctgtgagataaaaacaaatagagaattaaatccatttgccctat |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412726 |
ccaaatgcaccataatgctataacaaatatgctcgattgattagatgtcaacaattctgtgagataaaaacaaatagagaattaaatccatttgccctat |
6412627 |
T |
 |
| Q |
216 |
gc |
217 |
Q |
| |
|
|| |
|
|
| T |
6412626 |
gc |
6412625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University