View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14613_high_18 (Length: 212)
Name: NF14613_high_18
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14613_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 9 - 196
Target Start/End: Original strand, 11980716 - 11980903
Alignment:
| Q |
9 |
tcgaagaaaatgatgctacatttgtgtgcatatgggaggtgctgaaaatgactttcacattgaaggaggttgatagaaagtcgctcttaaaatttcaccg |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11980716 |
tcgaagagaatgatgctacatttgtgtgcatatgggaggcgctgaaaatgactttcacattgaaggaggttgatagaaagtcgctcttaaaatttcaccg |
11980815 |
T |
|
| Q |
109 |
gaggccggtaggcttgacttgcgttggaaacaaaggtttgctcttgtgttgcttgaaatcatgcaatatgtatcgtatcattatttac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11980816 |
gaggccggtaggcttgacttgcgttggaaacaaaggtttgctcttgtgttgcttgaaatcatgcaatatgtatcgtatgattatttac |
11980903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 85
Target Start/End: Original strand, 11954601 - 11954651
Alignment:
| Q |
35 |
tgcatatgggaggtgctgaaaatgactttcacattgaaggaggttgataga |
85 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
11954601 |
tgcatatgggaggtgcagaaaatgactttcttgctgaaggaggttgataga |
11954651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University