View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14613_high_9 (Length: 279)
Name: NF14613_high_9
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14613_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 2467040 - 2466796
Alignment:
| Q |
17 |
agtttatttccatggtggtggcttttgcattggttccacaacatggcttggttacaacaacttcctcggagatttctccgtcgcgtcacagtccattatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467040 |
agtttatttccatggtggtggcttttgcattggttccacaacatggcttggttacaacaacttcctcggagatttctccgtcgcgtcacagtccattatt |
2466941 |
T |
|
| Q |
117 |
ctctctgttgattaccggttagcaccggagcatcgtcttccaatagcttatgaagattgttactcatcacttgaatggcttggtgaaaatgtgaaaaccg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466940 |
ctctctgttgattaccggttagcaccggagaatcgtcttccaatagcttatgaagattgttactcatcacttgaatggcttggtgaaaatgtgaaaaccg |
2466841 |
T |
|
| Q |
217 |
aaccgtttctacgacatgctgatttatcaaatgtttttctctctg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466840 |
aaccgtttctacgacatgctgatttatcaaatgtttttctctctg |
2466796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University