View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14613_low_13 (Length: 237)
Name: NF14613_low_13
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14613_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 220
Target Start/End: Original strand, 34542917 - 34543121
Alignment:
| Q |
13 |
gaagaagaagaagagagtgatttgtgaagagctttggttagggtttcagcatcacgagatatgtaatcagatagccacgtgtcagtcatagctggacggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34542917 |
gaagaagaagaagagagtgatttgtgtagagctttggttagggtttcagcatcacgagatatgtaatcagatagccacgtgtcagtcatagctggacggt |
34543016 |
T |
 |
| Q |
113 |
acatccatgattcaatgctagctgctaaattctctgatgatgatgccatagcaatgaaagtgtttttggttacactacacttgcagtgtaacagttatgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34543017 |
acatccatgattcaatgctagctgctaaattctc---tgatgatgccatagcaatgaaagtgtttttggttacactacacttgcagtgtaacagttatgg |
34543113 |
T |
 |
| Q |
213 |
tagtgtgt |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
34543114 |
tagtgtgt |
34543121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University