View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14613_low_14 (Length: 236)

Name: NF14613_low_14
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14613_low_14
NF14613_low_14
[»] chr3 (2 HSPs)
chr3 (5-152)||(44428459-44428606)
chr3 (152-210)||(44428631-44428690)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 5 - 152
Target Start/End: Original strand, 44428459 - 44428606
Alignment:
5 gaagaaaagtgagttgaaaatttgcttagaatttactttttaacggctatgtggagtgaaagggatgagggtgtgtgtgtatttctttactacactcaaa 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
44428459 gaagaaaagtgagttgaaaatttgcttagaatttactttttaacggttatgtggagtgaaagggatgagggtgtgtgtgtatttctttactacactcaaa 44428558  T
105 attgcaagtctccccaatttcacgcctccaccctgaattggagagtaa 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
44428559 attgcaagtctccccaatttcacgcctccaccctgaattggagagtaa 44428606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 44428631 - 44428690
Alignment:
152 aaaagacagggaaataattgaaggaatgtcagaaaaac-agaacatcataggaggcaggg 210  Q
    |||| ||||||||||||||||||||||||||||||||| | |||||||||||||| ||||    
44428631 aaaaaacagggaaataattgaaggaatgtcagaaaaacaaaaacatcataggagggaggg 44428690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University