View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14613_low_15 (Length: 235)
Name: NF14613_low_15
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14613_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 95 - 223
Target Start/End: Complemental strand, 18723274 - 18723147
Alignment:
| Q |
95 |
tataaattgtgtctgtttcctatataacaaagaggatttcaaaatgctttgaaccgttgaacattttccttatgccactgaattatcccatagttttggc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18723274 |
tataaattgtgtctgtttcctatataacaaagaggatttcaaaatgctttgaaccgttgaacattttccttatgccactgaattatcccatagttttggc |
18723175 |
T |
 |
| Q |
195 |
ttgtattattgattttcccttatgccact |
223 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
18723174 |
ttgtattattgatttt-ccttatgccact |
18723147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University