View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14613_low_19 (Length: 222)
Name: NF14613_low_19
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14613_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 60 - 205
Target Start/End: Complemental strand, 7156508 - 7156356
Alignment:
| Q |
60 |
gggtcacgttgtctgttaattatata-gaactataatgatatatgctatattgcttc--------caaatttactcgcacattgtactaagaaagcctcg |
150 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156508 |
gggtcacgttgtctgttaattatataagaactataatgatatatgctatattgcttctaaatttacaaatttactcgcacattgtactaagaaagcctcg |
7156409 |
T |
|
| Q |
151 |
cannnnnnnnnnnnngaagttatagttgggatgcagagggattgcatgttgcatc |
205 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7156408 |
ca--tttttttttttgaagttatagatgggatgcagagggattgcatgttgcatc |
7156356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 7156530 - 7156496
Alignment:
| Q |
1 |
tcataataatattcatgtttatgggtcacgttgtc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156530 |
tcataataatattcatgtttatgggtcacgttgtc |
7156496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University