View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14613_low_20 (Length: 214)
Name: NF14613_low_20
Description: NF14613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14613_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 6412216 - 6412413
Alignment:
| Q |
16 |
ataggacagagtggaggaagagatttattgaagaaaatttcaatgttagggatgcttctagtattttgtcaataccgctttataaggtggtggatcaaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412216 |
ataggacagagtggaggaagagatttatt-aagaaaatttcaatgttagggatgcttctagtattttgtcaataccgctttataaggtggtggatcaaga |
6412314 |
T |
 |
| Q |
116 |
agatatagcaagctcaaagtttagtcccaccgaatttacagtgtaaagtttggatattactacgctaaggaacagttgatagacaatagcgaatactga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6412315 |
agatatagcaagctcaaagtttagtcccaccgaatttacagtgtaaagtttggatattactacgctaaggaacagttgatggacaatagcgaatactga |
6412413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 147
Target Start/End: Complemental strand, 13382297 - 13382218
Alignment:
| Q |
65 |
ggatgcttctagtattttgtcaataccgctttataaggtggtggatcaagaagatatagcaagctcaaagtttagtcccaccg |
147 |
Q |
| |
|
|||||| |||| |||||| ||||||||||||||||||| | ||||||||||||||| ||| ||||| | |||||| |||| |
|
|
| T |
13382297 |
ggatgcctctaatattttatcaataccgctttataaggatg---atcaagaagatatagtaagttcaaaatctagtcctaccg |
13382218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University