View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_high_37 (Length: 314)
Name: NF14614_high_37
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 58 - 149
Target Start/End: Original strand, 51705043 - 51705134
Alignment:
| Q |
58 |
aatttatgtatgttggcattcaacggcataatggagttacataaatcaaaagtctcaaccttccttaagttgcacgtgatattttcttccaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51705043 |
aatttatgtatgttggcattcaacggcataatggagttacataaatcaaaagtctcaaccttccttaagttgcacatgatattttcttccaa |
51705134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 156 - 198
Target Start/End: Complemental strand, 43072756 - 43072714
Alignment:
| Q |
156 |
tgctatatggtacgacaactttgtcgcaccgtttgcacgaata |
198 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
43072756 |
tgctatatggcacgacaactttgtcgcaccatttgcaagaata |
43072714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 36675744 - 36675809
Alignment:
| Q |
156 |
tgctatatggtacgacaactttgtcgcaccgtttgcacgaatagcttttgcccgtgtatatactca |
221 |
Q |
| |
|
|||||||||||||||||| | ||||||| | ||||||||||||||||| | | |||||||||||| |
|
|
| T |
36675744 |
tgctatatggtacgacaattgtgtcgcaacatttgcacgaatagctttatcacatgtatatactca |
36675809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 45954175 - 45954110
Alignment:
| Q |
156 |
tgctatatggtacgacaactttgtcgcaccgtttgcacgaatagcttttgcccgtgtatatactca |
221 |
Q |
| |
|
|||||||||||| ||||| | ||||||| | ||||||||||||||||| | | |||||||||||| |
|
|
| T |
45954175 |
tgctatatggtatgacaattgtgtcgcaacatttgcacgaatagctttatcacatgtatatactca |
45954110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University