View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_high_46 (Length: 282)
Name: NF14614_high_46
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_high_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 952198 - 951945
Alignment:
| Q |
18 |
ccttgacttcctaaaatttctttttaagatttatgtatcaagatttgtttcgattaaaattgtttattactgctctagctttattgtgttcgtgattctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
952198 |
ccttgacttcctaaaatttctttttaagatttatgtatcaagatttgtttcgattaaaattgtttattactgctctagctttattgtgttcgtgattctc |
952099 |
T |
 |
| Q |
118 |
gtatgtcatttgccacannnnnnncaatgtagtttaatttggattgcaatggtttgtctgttttccccgcagttgaaccttgtacgaccaaaaataaaat |
217 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
952098 |
gtatgccatttgccacatttttttcaatgtagtttaatttggattgcaatggtttgtctgttttccccgcagttgaaccttgtacgaccaataataaaat |
951999 |
T |
 |
| Q |
218 |
ctcaaaggatagattgagtgttggacaaatcatgtacaatttagcatgatgatg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
951998 |
ctcaaaggatagattgagtgttggacaaatcatgtacaatttagcatgatgatg |
951945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University