View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_high_54 (Length: 250)
Name: NF14614_high_54
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 92 - 219
Target Start/End: Original strand, 5525869 - 5525996
Alignment:
| Q |
92 |
tttgtacggagttctcttttgcttgttgttatgatttttaatgaaaaatgtttcacatttgttacggtgatagtgtctttcaagtttcaggtatgctaag |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
5525869 |
tttgtacggagttctcttttgcttgttgttatgctttttaatgaacaatgtttcacatttgttatggtgatagagtctttcaagtttcaggtatgctaag |
5525968 |
T |
 |
| Q |
192 |
gaggttccatttggttcacaagaagtat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5525969 |
gaggttccatttggttcacaagaagtat |
5525996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 5525727 - 5525819
Alignment:
| Q |
1 |
tgaggcatccaaatgtggttctcttcatgggagctgtaactcgacctccaaatttggttacaagactttattattagtgactaggttaaccttt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
5525727 |
tgaggcatccaaatgtggttctcttcatgggagctgtaattcgacctccaaatttggttacaagactttattatttgtga-taggttaaccttt |
5525819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 92 - 232
Target Start/End: Original strand, 48223632 - 48223772
Alignment:
| Q |
92 |
tttgtacggagttctcttttgcttgttgttatgatttttaatgaaaaatgtttcacatttgttacggtgatagtgtctttcaagtttcaggtatgctaag |
191 |
Q |
| |
|
||||||| ||||||| ||||||||||||| || ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48223632 |
tttgtacatagttctcctttgcttgttgttctgttttttaatgaaaaatgtttcacatttgttttggtgataatgtctttcaagtttcaggtatgctaag |
48223731 |
T |
 |
| Q |
192 |
gaggttccatttggttcacaagaagtatctgtgtctgctgt |
232 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
48223732 |
gaggttccatttggtttacaagaagtacttgtgtctgctgt |
48223772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 99 - 211
Target Start/End: Complemental strand, 23657132 - 23657017
Alignment:
| Q |
99 |
ggagttctcttttgcttgttgttatgatttttaatgaaaaatg--tttcacatttgttacggtgatagtgtctttcaagtttcaggt-atgctaaggagg |
195 |
Q |
| |
|
|||||| ||| || |||| ||||||| ||||||||||| | | |||||||||||||| | ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23657132 |
ggagttatctcttccttgatgttatgctttttaatgaacgaggggtttcacatttgttatgatgatagtgtctttcaagtttcaggtgatgctaaggaga |
23657033 |
T |
 |
| Q |
196 |
ttccatttggttcaca |
211 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
23657032 |
ttctatttggttcaca |
23657017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 30005593 - 30005645
Alignment:
| Q |
1 |
tgaggcatccaaatgtggttctcttcatgggagctgtaactcgacctccaaat |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30005593 |
tgaggcatccaaatgtggttctcttcatgggagctgtaattcgacctccaaat |
30005645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 45203436 - 45203488
Alignment:
| Q |
1 |
tgaggcatccaaatgtggttctcttcatgggagctgtaactcgacctccaaat |
53 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
45203436 |
tgaggcatccaaatgttgttctcttcatgggagctataactagacctccaaat |
45203488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 43262207 - 43262165
Alignment:
| Q |
52 |
atttggttacaagactttattattagtgactaggttaaccttt |
94 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
43262207 |
atttggttacaagactttattattagagactaggttaatcttt |
43262165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 36229201 - 36229243
Alignment:
| Q |
52 |
atttggttacaagactttattattagtgactaggttaaccttt |
94 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
36229201 |
atttcgttacatgactttattattagagactaggttaaccttt |
36229243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University