View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_high_73 (Length: 204)
Name: NF14614_high_73
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_high_73 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 10029734 - 10029531
Alignment:
| Q |
1 |
ggaaaaccatggaagtcgtgttccttccaattcggcgaatccaggcttaattttaagggaattgaagcaagcgaaattgaatctaaaccgagcaacaaac |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
10029734 |
ggaaaaccatgggagtcgtgttccttccaattcggcgagtccaggcttaattttaagggaattgaagcaagcgaaattgaatctaaaccgaacaacgaat |
10029635 |
T |
|
| Q |
101 |
aatatcgctgatgttcgag-----gtggaatcactcaaaaagaaacttcagaaggaaattaaaggatatcactcgagaaaaccagagagagttcaactca |
195 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||| |||||| |
|
|
| T |
10029634 |
gatattgctgatgttcgagtttctgtggaatcactcaacaagaaacttcagaaggaaa-----gaatatcactcgagaaaaccagagagagtttaactca |
10029540 |
T |
|
| Q |
196 |
gaattcttc |
204 |
Q |
| |
|
||||||||| |
|
|
| T |
10029539 |
gaattcttc |
10029531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University