View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_32 (Length: 346)
Name: NF14614_low_32
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 8069416 - 8069756
Alignment:
| Q |
1 |
cttgttgtgtgtctaatgaactaaaagaaatgtatggcaaattcattgttattaattgcgtttgtgatcacagttgcggttatgctacaaactttgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8069416 |
cttgttgtgtgtctaatgaactaaaagaaatgtatggcaaattcattgttattaattgcgtttgtgatcacagttgcggttatgctacaaactttgattt |
8069515 |
T |
 |
| Q |
101 |
tgtggtgaaaaaatggtgaatgtggccgaggcagacgcaattacaattgcaatgtcattttagagatctctaaaacatttatattgcggctgcaattgcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8069516 |
tgtggtgaaaaaatggtgaatgtggccgaggcagacgcaattacaattgcaatgtcattttagagatctctaaaacctttatattgcggctgcaattgcg |
8069615 |
T |
 |
| Q |
201 |
gttgcaggactcgatttaaatttaaataaataaacatgttgtatgtctaatgaaatattggtttgtggttgaattgcaggcagggcaattgggagtgctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8069616 |
gttgcaggactcgatttaaatttaaataaataaacatgttgtatgtctaatgaaatattggtttgtggttgaattgcaggcagggcaattgggagtgctt |
8069715 |
T |
 |
| Q |
301 |
tcaattttctgccctgcatgatatgagtgcttgattcttct |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8069716 |
tcaattttctgccctgcatgatatgagtgcttgattcttct |
8069756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 205
Target Start/End: Complemental strand, 10725413 - 10725371
Alignment:
| Q |
163 |
gagatctctaaaacatttatattgcggctgcaattgcggttgc |
205 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
10725413 |
gagatctctaaaacctttatattgcggttgcaattgtggttgc |
10725371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University