View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_40 (Length: 319)
Name: NF14614_low_40
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 212 - 303
Target Start/End: Complemental strand, 13127859 - 13127768
Alignment:
| Q |
212 |
tagtgctattcctattgattcaaatttaaacatacatacatttacatgatttgaaataacttaatctttgcaagaatatcactccatgattt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13127859 |
tagtgctattcctattgattcaaatttaaacatacatacatttacatgatttgaaataacttaatctttgcaagaatatcactctatgattt |
13127768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 74 - 135
Target Start/End: Complemental strand, 13128146 - 13128085
Alignment:
| Q |
74 |
gactctttctaatcatgaactggtaagctcaactaatataccaggttgtatcatgattaatc |
135 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13128146 |
gactctttctaatcatgacctggtaagctcaactaatataccaggctgtatcatgattaatc |
13128085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University