View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_41 (Length: 319)
Name: NF14614_low_41
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_41 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 9 - 319
Target Start/End: Original strand, 44725201 - 44725511
Alignment:
| Q |
9 |
aatattggcattactcgaaaataaccctagtttgagccaattaatcggatttgtgttggataagaactcggcattagagaagccaaaagcttgccaaaga |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44725201 |
aatattggcattacttgaaaataaccctagtttgagccaattaatcggatttgtgttggataagaactcggcattagagaagccaaaagcttgccaaaga |
44725300 |
T |
 |
| Q |
109 |
gaacgagaggctaatggatctctaatgcactgaaggaaagattcttcttccgaattgaactgatggcaatgctattgggagccatgttacaatgatgaag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44725301 |
gaacgagaggctaatggatctctaatgcactgaaggaaatattcttcttccgaattgaactgatggcaatgctattgggagccatgttacaatgatgaag |
44725400 |
T |
 |
| Q |
209 |
caaaggaatcattgttacaaagttgttacaagtcaaccatacaagaaactagatcttttcaggcaaatggagtcgtcatatccaagactatgatagagta |
308 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44725401 |
caaagggatcattgttacaaagttgttacaagtcaaccatacaagaaactagatcttttcaggcaaatgaagtcgtcatatccaagactatgatagagta |
44725500 |
T |
 |
| Q |
309 |
gttgtattcat |
319 |
Q |
| |
|
||||||||||| |
|
|
| T |
44725501 |
gttgtattcat |
44725511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University