View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_45 (Length: 300)
Name: NF14614_low_45
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 7 - 282
Target Start/End: Complemental strand, 35850865 - 35850590
Alignment:
| Q |
7 |
tcgagtgagatgaatgtggaagatcaagaggaatcacaagatgtgatggacgatgattctagggattcctgttctgatgctgagacgccggttgaattgc |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850865 |
tcgagtgaattgaatgtggaagatcaagaggaatcacaagatgtgatggacgatgattctagggattcctgttctgatgctgagacgccggttgaattgc |
35850766 |
T |
|
| Q |
107 |
ctgtggcattagaattgccgccaccgttagagttgccgccgtcttctggaactattggtgtgccagagaagtatgtttcgtacttgttttcggtatatgg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850765 |
ctgtggcattagaattgccgccaccgttagagttgccgccgtcttctggaactattggtgtgccagagaagtatgtttcgtacttgttttcggtatatgg |
35850666 |
T |
|
| Q |
207 |
attcttacgctcgttcagtattcgattgtttctttatccgtttagtttggatgatttcgtcggtgcccttaactgt |
282 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850665 |
attcttacgctcgttcagtattcaattgtttctttatccgtttagtttggatgatttcgtcggtgcccttaactgt |
35850590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 17 - 282
Target Start/End: Complemental strand, 35841238 - 35840973
Alignment:
| Q |
17 |
tgaatgtggaagatcaagaggaatcacaagatgtgatggacgatgattctagggattcctgttctgatgctgagacgccggttgaattgcctgtggcatt |
116 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||| |||||||||||||||||||||| ||||| |||||||||| ||||||||||||| ||||||| |
|
|
| T |
35841238 |
tgaatgcggaagatcaagaggattcacgagatgttatggacgatgattctagggatttgtgttcggatgctgagataccggttgaattgctggtggcatc |
35841139 |
T |
|
| Q |
117 |
agaattgccgccaccgttagagttgccgccgtcttctggaactattggtgtgccagagaagtatgtttcgtacttgttttcggtatatggattcttacgc |
216 |
Q |
| |
|
||||||| |||| || || ||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35841138 |
agaattgtcgccgcctttggagttaccgccgtcttcaggaactattggtgtgccggagaagtatgtttcgtacttgttttcggtatatggattcttacga |
35841039 |
T |
|
| Q |
217 |
tcgttcagtattcgattgtttctttatccgtttagtttggatgatttcgtcggtgcccttaactgt |
282 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
35841038 |
tcattcagtattcgattgtttctttatccgtttagtttggatgatttcgtcggggctcttaactgt |
35840973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University