View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_47 (Length: 292)
Name: NF14614_low_47
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 25968469 - 25968284
Alignment:
| Q |
1 |
aggaaagaatttttctcatggaaagggaattgggtgacttgaggcagcgtgttgtatgcttggaggccggggg-aattggcactggtgataacgagtctg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
25968469 |
aggaaagaatttttctcatggaaagggaattgggtgacttgaggcagcgtgttgtatgctttgagaccggggggaattggcgctggtgataacgagtctg |
25968370 |
T |
|
| Q |
100 |
agaatttcaacgaccaagatgtttgcttggagaagagcatcgaaaatggtgaccatat-aacagcaagagtgaagacaattgacaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25968369 |
agaatttcaacgaccaagatgtttgcttggagaagagcatcgaaaatggtgaccatatcaacagcaagagtgaagacaattgacaa |
25968284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 25990537 - 25990387
Alignment:
| Q |
1 |
aggaaagaatttttctcatggaaagggaattgggtgacttgaggcagcgtgttgtatgcttggaggccgggggaattggcactggtgataacgagtctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||| |||| |||||||| |||||||| |
|
|
| T |
25990537 |
aggaaagaatttttctcatggaaagggaattgagtgatttgaggcagcgtgttgtatgcttggagaccgagggaaatggcgctggtgatcgtgagtctga |
25990438 |
T |
|
| Q |
101 |
gaatttcaacgaccaagatgtttgcttggagaagagcatcgaaaatggtga |
151 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
25990437 |
gaatttcaacggcatagatgtttgctcggagaagagcgtcggaaatggtga |
25990387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 274
Target Start/End: Original strand, 6898421 - 6898459
Alignment:
| Q |
236 |
gggagaggattgtctcctgtgagattttctccagtgaac |
274 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6898421 |
gggagaggattgtctcccgtgagattttctccagtgaac |
6898459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University