View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_53 (Length: 279)
Name: NF14614_low_53
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 520028 - 519833
Alignment:
| Q |
20 |
acgtgcaatgcattggtgctgtctgtgacacacacatggtaccatccatgcacatggagagtttttcattctccaaggttcttgttacaaacaacttttt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
520028 |
acgtgcaatgcattggtgctgtctgtgacacacacatggtaccat----gcacatggagagtttttcattctccaaggttgttgttacaaacaactttta |
519933 |
T |
 |
| Q |
120 |
gatggtaagttgcaagggaccaaggggtcccggtccctctaagaaaaaccggtatggcattaattataattaatttttataaatatagcaaactgctaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
519932 |
gatggtaagttgcaagggaccaaggggtcccggtccctctaagaaaaaccggtatggcatta------attaatttatataaatatagcaaactgctaaa |
519839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University