View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_55 (Length: 269)
Name: NF14614_low_55
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 115 - 254
Target Start/End: Complemental strand, 4638996 - 4638859
Alignment:
| Q |
115 |
gagtaaatatgctttgttttttgcttttaaaaagaatgattagtgctttctacaaaaatcattcaacgattaaaggaagacaaaaaatgtatgtctacta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
4638996 |
gagtaaatatgctttgttttttgcttttaaaaagaatgattagtgctttctacaaaaatcattcaacgattaaagga--aaaaaaaatgtatgtctacta |
4638899 |
T |
 |
| Q |
215 |
aaatcattcacgattaatcattgactagccatttgtattt |
254 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4638898 |
aaatcattcacgattaatcattggctagccatttgtattt |
4638859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 4639059 - 4639020
Alignment:
| Q |
1 |
ttaatattatgggggtttattacgaatagcttcaaatatg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4639059 |
ttaatattatgggggtttattacgaatagcttcaaatatg |
4639020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University