View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_56 (Length: 269)
Name: NF14614_low_56
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 257
Target Start/End: Complemental strand, 12328038 - 12327799
Alignment:
| Q |
19 |
caccattcatatggatatacttcacctcaagcggaaattactttttgatcacccacgtaatacttgcattgtcgatggcactcaacaccaacataacgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12328038 |
caccattcatatggatatacttcacctcaagcagaaattactttttgatcacccacgtaatacttgcattgtcgatggcactcaacaccaacataacgtg |
12327939 |
T |
 |
| Q |
119 |
tcatatgacctccatatttt-ttaaagactttcgatacaatgaatcagacaaatttagtcaaaccatcgactctgatagcactattagttccatcgatca |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
12327938 |
tcatatgacctccatattttcataaagactttcgatacaatgaatcagacaaatttagtcaaatcaacgactctgatagcactattagttccatcgatca |
12327839 |
T |
 |
| Q |
218 |
acaatcttattgtccgacctcattgtaagaaacacaggtt |
257 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12327838 |
acaatcttattgtccgacctcgttgtaagaaacacaggtt |
12327799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University