View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_59 (Length: 257)
Name: NF14614_low_59
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 39369950 - 39370188
Alignment:
| Q |
1 |
aaatgtttttgattgttgaagttgttttgttttgggagagatatatgttttaattgattgacacctattgaaacccttcttaaaatagtaatgaaggtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39369950 |
aaatgtttttgattgttgaagttgttttgttttgggagagatatatgttt-aattgattgacacctattgaaacccttcttaaaatagtaatgaaggtgt |
39370048 |
T |
 |
| Q |
101 |
acaatattaagatgagaaaagattgtgagagaaacctttgtaactttatagttaagcattgttggcttatc-nnnnnnnctttctttctaaattgacaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
39370049 |
acaatattaagatgagaaaagattgtgagagaaacctttgtaactttatagttaagcattgttggcttatctttcttttctttctttctcaattgacaaa |
39370148 |
T |
 |
| Q |
200 |
tttccatatgtagtgtgttgaagaagcttgcgaggtagcata |
241 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39370149 |
tttcc--atgtagtgtgttgaagaagcttgcgaggtagcata |
39370188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University