View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_61 (Length: 247)
Name: NF14614_low_61
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 3 - 56
Target Start/End: Complemental strand, 21732235 - 21732182
Alignment:
| Q |
3 |
aatgagatgaacaataacacaataaaatcaaagaacaataacactatcacgctg |
56 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21732235 |
aatgaaatgaacaataacacaataaaatcaaagaacaataacactatcacgctg |
21732182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University