View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_68 (Length: 229)
Name: NF14614_low_68
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 149
Target Start/End: Original strand, 41741913 - 41742044
Alignment:
| Q |
18 |
aaagattaacgatctgatcctaactgtctcacctcacgtgattggtatgccttctgtccgctcacgtgtcgttttggtatttgccttactactgcggcat |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41741913 |
aaagattaactatctgatcctaactgtctcacctcacgtgattggtatgccttctgtccgctcacgtgtcgttttggtatttgccttactactgcgccat |
41742012 |
T |
 |
| Q |
118 |
atcgttttcgtctcgtagtatcttcaaaggat |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41742013 |
atcgttttcgtctcgtagtatcttcaaaggat |
41742044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University