View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14614_low_68 (Length: 229)

Name: NF14614_low_68
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14614_low_68
NF14614_low_68
[»] chr8 (1 HSPs)
chr8 (18-149)||(41741913-41742044)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 149
Target Start/End: Original strand, 41741913 - 41742044
Alignment:
18 aaagattaacgatctgatcctaactgtctcacctcacgtgattggtatgccttctgtccgctcacgtgtcgttttggtatttgccttactactgcggcat 117  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
41741913 aaagattaactatctgatcctaactgtctcacctcacgtgattggtatgccttctgtccgctcacgtgtcgttttggtatttgccttactactgcgccat 41742012  T
118 atcgttttcgtctcgtagtatcttcaaaggat 149  Q
    ||||||||||||||||||||||||||||||||    
41742013 atcgttttcgtctcgtagtatcttcaaaggat 41742044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University