View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_69 (Length: 228)
Name: NF14614_low_69
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 213
Target Start/End: Original strand, 30312465 - 30312673
Alignment:
| Q |
5 |
gaatgaaaataaactcgcttgcatggagtttaagtttacattatatacgcaggaaaataaactaacaaattgttgcatgtgtgccatgtgttctttaact |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30312465 |
gaatgaaaataaactcgcttgcatggagtttaagtttacattatatacgcaggaaaataaactaacaaattgttgcatgtgtgccatgtgtcctttaact |
30312564 |
T |
 |
| Q |
105 |
tccaagagcttcctgttgtaacttgtcttttgaattttgatctttggcacttcaagggaataattgctgctcttggaacttattgtgcggtctactagtg |
204 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30312565 |
tccaagagcttcctgttgtaacttctcttttgaattttgatctttggcacttcaagggaataattgctgctcttggaacttattgtgcggtctactagtg |
30312664 |
T |
 |
| Q |
205 |
gcagtttct |
213 |
Q |
| |
|
||||||||| |
|
|
| T |
30312665 |
gcagtttct |
30312673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University