View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_74 (Length: 222)
Name: NF14614_low_74
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 35643502 - 35643406
Alignment:
| Q |
1 |
ggagttttgtttaacacaagggggttgtatggctgtaaaattagcttataaaatattatgatacaccaattagattatcttatcacctagttaagca |
97 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35643502 |
ggagttttgtttaacacaagagggttgtatggctgtaaaattagcttataaaatattatgatacacaaattagattatcttatcacctagttaagca |
35643406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 35643310 - 35643269
Alignment:
| Q |
174 |
agctccactatgtcttatgcaatttgttttacatgtgatatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35643310 |
agctccactatgtcttatgcaatttgttttacatgtgatatt |
35643269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University